International Journal of Pharmaceutical and Phytopharmacological Research
ISSN (Print): 2250-1029
ISSN (Online): 2249-6084
Publish with eIJPPR Submission
2020   Volume 10   Issue 2

Point Mutations in gyrA and parC Genes of Quinolone-Resistant Chlamydia Trachomatis in Iranian Women

Roya Torabizadeh1, 2

 

1 Department of Medical Microbiology, Alborz university of Medical Sciences, Karaj, Iran.

2 Department of Microbiology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran.

ABSTRACT

Background: Antimicrobial resistance is an increasingly common global issue, resulting in millions of death each year. Due to the emergence of bacterial resistance, it is not possible to fully treat some infections. According to a report by the World Health Organization (WHO) in April 2014, antimicrobial resistance is not a future prediction, but in fact a phenomenon happening right now, with the potential to affect people from different countries and age groups. Antibiotic resistance is characterized by bacterial changes, leading to the inefficacy of antibiotics in infection treatment. Today, antibiotic resistance is recognized as a major public health issue. Many studies have reported antibiotic resistance in different bacteria. Although, there are many reports about the prevalence of STD agents, there are only few documented reports of antibiotic resistance in chlamydia trachomatis. tetracyclines, quinolones, and azalides are common agents used in the treatment of infections. The present study aimed to evaluate resistance to quinolones among Iranian women with chlamydial infection. Material and Methods: This study included 300 women, who were referred to the obstetrics and gynecology clinics of teaching hospitals, affiliated to Shahid Beheshti University of Medical Sciences (Tehran, Iran) for abnormal vaginal discharge and recurrent infection (October 2012-2014). DNA sequencing, as well as polymerase chain reaction (PCR) assay, was performed to evaluate genetic resistance to quinolones. Results: The findings indicated point mutations in gyrase subunit A (gyrA) and topoisomerase IV subunit C (parC) genes of Chlamydia trachomatis strains from Iranian women. As the analysis of mutations indicated, they were in the quinolone resistance-determining regions (QRDRs) at positions 86, 93, 130, 131, 132, 134, and 135, of gyrA gene and positions 94 and 80, of parC gene. Conclusion: Based on the results, there have been some point mutations inside and outside QRDRs; this finding confirmed the resistance of chlamydial strains in Iranian women, treated by different classes of antibiotics.

Key Words: Chlamydia trachomatis, gyrA, parC, quinolone resistance, Antimicrobial resistance.

INTRODUCTION

 Chlamydia trachomatis is a Gram-negative bacterium, associated with four categories of diseases: 1) occular trachoma leading to blindness; 2) occulogenital diseases causing infertility, pelvic inflammatory disease, and reactive arthritis in adults; 3) lymphogranuloma venereum; and 4) perinatal infections [1-3]. Tetracycline, macrolides, and quinolones are among antibiotics used to treat chlamydial infections. On the other hand, the overuse of antimicrobial drugs has become a growing public health issue, leading to the increased antibiotic resistance of bacteria.

Despite proper drug treatment, chlamydial infections have shown a 5% to 20% recurrence rate [4-6]. The use of quinolones is quite common in many countries considering the low price and high accessibility of these drugs. Generally, quinolones are known as broad-spectrum antibacterial drugs in veterinary and clinical medicine. Considering the extensive use of these agents, different bacteria have shown increasing resistance. Quinolones function through exerting inhibitory effects on gyrase and topoisomerase IV in bacteria.

Fluoroquinolone resistance is associated with point mutations in the quinolone resistance-determining regions (QRDRs) of DNA gyrase (gyrA) and topoisomerase IV (parC) genes .Moreover, studies on Escherichia coli have indicated that mutations in codons 67, 82, 83, 84, and 106 of gyrA gene are responsible for resistance to quinolones [7, 8]. On the other hand, mutations at codons 80 and 84 in parC gene are responsible for resistance [9-11].

With this background in mind, the present study aimed to examine the drug resistance of C. trachomatis in Iranian women owing to the widespread use of quinolones and identify mutation-induced resistance for the prevention of inappropriate drug use and infection relapse.

MATERIALS AND METHODS

Statement of Ethics

This study was approved by the Ethics Committee of Shahid Beheshti University of Medical Sciences (SBMU.REC.1392.416). The Infectious Diseases and Tropical Medicine Research Center of the university funded the study (grant No, 416).

Vaginal discharge sampling was performed according to World Health Organization guidelines (using a speculum and dacron swabs).

94 C. trachomatis isolates were collected from 300 samples, which  consisted  of  women with middle age of 29  and having abnormal vaginal discharge and a history of  recurrent infection with using different classes of antibiotics such as Penicillins, Cephalosporins, quinolones, and were admitted to Shahid Beheshti teaching hospitals Tehran, Iran, from October 2012 to December 2014.

The confirmed C. trachomatis samples were stored at -70°C on 2SP medium (containing 20% glycerol) and subjected to molecular identification.

DNA extraction and PCR assay

For DNA extraction, the 2SP medium was used according to the DNA extraction kit (Bioneer, Korea). For identification of mutation regions in gyrA and parC genes, CTA3, CTA4, CTC3, and CTC4 primers were used from the literature [12]. CTA3 and CTA4 primers with nucleotide sequences of gyrA, as well as CTC3 and CTC4 primers with nucleotide sequences of parC gene, have been presented in the following table:

Table 1. CTA3 and CTA4 primers with nucleotide sequences of gyrA, and  CTC3 and CTC4 primers with nucleotide sequences of parC gene

Genes

Primers

Nucleotide sequence

Fragment length (bp)

gyrA

CTA3

5'TTAAAACCTTCTCAGCGACG3'

362

gyrA

CTA4

5'GAAGGAAAAACTACAGGTTC3'

362

parC

CTC3

5'ATGGCCTCAAGCCTGTTCA3'

201

parC

CTC3

5'CAGTGGATTGCCAAAGTTCCC3'

201

 

To amplify 362-bp fragments from gyrA gene, PCR assay was performed in a thermocycler (AG22331; Eppendorf, Germany) under the following conditions: initial denaturation at 95ºC for 5 minutes; 35 cycles at 95ºC for 1 minute, at 41ºC for 1 minute, and at 72ºC for 2 minutes; and final extension at 72ºC for 10 minutes. Following the amplification process, the PCR products were added to 2% Agarose gel. In addition, for amplification of 201-bp fragments of parC gene, PCR assay was conducted in a thermocycler (AG 22331; Eppendorf, Germany) under the following conditions: denaturation at 95ºC for 5 minutes; 35 cycles at 95ºC for 1 minute, at 60ºC for 1 minute, and at 72ºC for 2 minutes; and extension at 72ºC for 10 minutes. The final products were then added to 2% Agarose gel.

For sequencing the genes, the samples were sent to Takapouzist Company (Iran).

Mutation was identified by comparing translated amino acid sequences  to reference to gyrA  and parC gene NCBI,GENE BANK , T-BLAST X tool.

RESULT

 

Fig. 1. PCR amplification of gyrA gene from chlamydia-positive patients: lane 1, DNA ladder (1000 bp); lanes 2, 3, 6, 7, 14, 15, positive sample; lane 12, positive control; lane 13, negative control.

Amino acid mutations in C. trachomatis samples

According to the analysis of amino acid changes in gyrA proteins, mutations were as follows:

  • conversion of amino acid from serine to lucien at position 86 
  • deletion of amino acid at position 93 (proline)
  • conversion from threonine to proline at position 130
  • conversion from threonine to valine at position 130
  • conversion from serine to valine at position 131
  • conversion from serine to valine at position 132
  • conversion from threonine to proline at position 134
  • conversion from cysteine to serine at position 135

Analysis of parC gene

PCR and electrophoresis were performed using a pair of primers to detect mutations in parC gene. In 22% of the samples, 201-bp bands were formed (Figure 2).

 

Fig. 2. PCR amplification of parC gene from chlamydia-positive patients: lane 1, DNA ladder (1000 bp); lanes 2, 3, 7, positive sample; lane 11, negative control; lane 12, positive control.

According to the analysis of amino acid changes in parC proteins, mutations were as follows:

In parC proteins, mutations were as follows:

  • conversion of amino acid from threonine to alanine at position 94
  • conversion from serine to arginine at position 80

DISCUSSION

In the present study, 300 samples were examined for C. trachomatis, using nested PCR. After detecting the positive samples, PCR assay was used to amplify parC and gyrA genes. Following that, by sequencing the genes and converting them into proteins, mutations and changes in amino acids, leading to quinolone resistance, were examined.

Although there have been various studies on the prevalence of STDs related to Neisseria gonorrhoeae and C. trachomatis in Iran [13-16], as well as other countries, there have been fewer reports about drug resistance of bacteria, especially C. trachomatis. Nonetheless, there have been reports of recurrent C. trachomatis infection, which can be associated with the lack of proper treatment and drug resistance to different antibiotics in C. trachomatis [17]. For decades, tetracycline and erythromycin have been used to treat C. trachomatis infections. Moreover, macrolides, such as erythromycin or azalides (e.g., azithromycin) have been used owing to their high concentration in the cells. The first case of C. trachomatis resistance was reported in 1990 by Jones et al. [18]. Subsequently, a C. trachomatis strain, resistant to 64 μg/mL of tetracycline, was reported in France. In addition, three C. trachomatis strains were isolated in the United States, which showed multidrug resistance to azithromycin, ofloxacin, and doxycycline.

In the past, it was assumed that bacteria with an intracellular life cannot easily acquire drug resistance. However, according to the literature, C. trachomatis can acquire adenosine diphosphate/adenosine triphosphate (ADP/ATP) translocase enzymes from plants; therefore, there has been a possibility of horizontal transfer of drug-resistant and alien genes [19, 20].

A study by Dessus-Babus et al. showed that if C. trachomatis L2 strains were exposed to subinhibitory concentrations of fluoroquinolones, they underwent mutations in gyrA gene, and amino acid conversion occurred at position 83 (conversion of serine to leucine). Nevertheless, no changes were observed in gyrB, parC, or parE genes [12].

In 2002, Morrissey et al. showed that if C. trachomatis and Pneumococcus were exposed to subinhibitory concentrations of fluoroquinolones, the minimum inhibitory concentration increased after 30 passages in the cell culture. Based on the molecular methods, amino acid 83 converted from serine to isoleucine in gyrA gene [21].

In addition,  studies by Rachel Binet et al. revealed that mutations in chlamydial rRNA genes, similar to Mycobacterium and Helicobacter, resulted in resistance to drugs, such as tetracycline and macrolides [22-24]. Moreover, in a study by Shigeaki Yokoi et al. from Japan (2004) on 23 C. trachomatis isolates, collected from men with nongonococcal urinary tract infection, 12 isolates showed an amino acid conversion in parC gene. Arginine 83 was converted to glycine, and in one case, arginine was converted to cysteine 66 [25].

In the present study, the analysis and comparison of the collected strains showed gyrA and parC gene mutations. Mutations in gyrA gene were characterized by amino acid changes at positions 86, 94, 131, 132, 134, and 135, including QRDRs (amino acids 67-106). Additionally, in parC gene, mutations occurred in amino acids 80 and 94, which were also located in the QRDR. The obtained results were in agreement with the other similar studies around the world. However, differences in the position of amino acids might be associated with the endemicity of Iranian strains.

CONCLUSION

Regarding the presence of mutations in parC and gyrA genes from the isolated samples of Iranian women, the use of precise methods, including culture and molecular assays such as PCR, has been suggested to detect bacteria. According to the results, appropriate antibiotics should be selected in order to prevent the recurrence and consequences of infection, including pelvic inflammatory disorder, which are both costly and disturbing for patients.

ACKNOWLEDGEMENTS

The Faculty of Medicine of Shahid Beheshti University of Medical Sciences supported this study. The author appreciates the faculty members of Medical Microbiology Department for their sincere contribution.

REFERENCES

  1. Mandell G, Bennett J, Dolin R. Mandell, Douglas, and Bennett's principles and practice of infectious diseases. 7th ed.; 2010.
  2. Borriello SP, Murray PR, Funke G. Topley and Wilson's microbiology and microbial infections. 10th ed.; 2010.
  3. Stamm WE. Chlamydia trachomatis infections of the adult. Sexually transmitted diseases. 4th ed.; 2008. p. 575.
  4. Sandoz KM, Rockey DD. Antibiotic resistance in Chlamydiae. Future Microbiol. 2010;5(9):1427-42. doi:10.2217/fmb.10.96. [PubMed:20860486]. [3075073:3075073].
  5. Kohlhoff SA, Hammerschlag MR. Treatment of Chlamydial infections: 2014 update. Expert Opin Pharmacother. 2015;16(2):205-12.
  6. UpToDate - Treatment of Chlamydia trachomatis infection. 2018; Available from: https://www.uptodate.com/contents/treatment-of-chlamydia-trachomatis-infection.
  7. Ruiz J. Mechanisms of resistance to quinolones: target alterations, decreased accumulation and DNA gyrase protection. J Antimicrob Chemother. 2003;51(5):1109-17. doi:10.1093/jac/dkg222. [PubMed:12697644].
  8. Emmerson AM. The quinolones: decades of development and use. J Antimicrob Chemother. 2003;51(90001):13-20. doi:10.1093/jac/dkg208.
  9. Dalhoff A. Global fluroquinolone resistanious epidemiology and implications for clinical use.Interdisciplinary perspectives on infectious diseases. J Global Infect Dis. 2010(2):258-62.
  10. Gellert M, Mizuuchi K, O'Dea MH, Itoh T, Tomizawa JI. Nalidixic acid resistance: a second genetic character involved in DNA gyrase activity. Proc Natl Acad Sci U S A. 1977;74(11):4772-6. [PubMed:337300]. [432037:432037].
  11. Khodursky AB, Zechiedrich EL, Cozzarelli NR. Topoisomerase IV is a target of quinolones in Escherichia coli. Proc Natl Acad Sci U S A. 1995;92(25):11801-5. [PubMed:8524852]. [40490:40490].
  12. Dessus-Babus S, Bebear CM, Charron A, Bebear C, de Barbeyrac B. Sequencing of gyrase and topoisomerase IV quinolone-resistance-determining regions of Chlamydia trachomatis and characterization of quinolone-resistant mutants obtained In vitro. Antimicrob Agents Chemother. 1998;42(10):2474-81. [PubMed:9756744]. [105861:105861].
  13. Afrasiabi S, Moniri R, Samimi M, Mousavi SG. The frequency of Neisseria gonorrhoeae endocervical infection among female carrier and changing trends of antimicrobial susceptibility patterns in Kashan, Iran. Iran J Microbiol. 2014;6(3):194-7. [PubMed:25870754]. [4393497:4393497].
  14. Rashidi B, Chamani Tabriz L, Haghollahi F, Jeddi-Tehrani M, Ramezanzadeh F, Rahimi Foroushani A, et al. Prevalence of neisseria gonorrhea in fertile and infertile women in Tehran. Med J Reprod Infertil. 2009;9(4):379–83.
  15. Torabizadeh R, Eslami G, Dehghantarzejani M, Zahirnia Z, Habibi M. The prevalence of neisseria gonoroheae among Iranian women by phenotyping and genotyping methods. J Pure Appl Microbiol. 2016;10(4):2669-72. doi:10.22207/jpam.10.4.25.
  16. Eslami G, Torabizadeh R, Goudarzi H, Sadat Hosseini M, Farzaneh F, Khosravi D and Mehdi Gudarzi. Prevalence of Chlamydia trachomatis among Iranian women,Tehran, Iran. J Pure Appl Microbiol. 2014;8(6):4477-80.
  17. Suchland RJ, Sandoz KM, Jeffrey BM, Stamm WE, Rockey DD. Horizontal transfer of tetracycline resistance among Chlamydia spp. in vitro. Antimicrob Agents Chemother. 2009;53(11):4604-11. doi:10.1128/AAC.00477-09. [PubMed:19687238]. [2772348:2772348].
  18. Jones RB, Van der Pol B, Martin DH, Shepard MK. Partial characterization of Chlamydia trachomatis isolates resistant to multiple antibiotics. J Infect Dis. 1990;162(6):1309-15. [PubMed:2230260].
  19. Lefevre JC, Lepargneur JP. Comparative in vitro susceptibility of a tetracycline-resistant Chlamydia trachomatis strain isolated in Toulouse (France). Sex Transm Dis. 1998;25(7):350-2. [PubMed:9713914].
  20. Somani J, Bhullar VB, Workowski KA, Farshy CE, Black CM. Multiple drug-resistant Chlamydia trachomatis associated with clinical treatment failure. J Infect Dis. 2000;181(4):1421-7. doi:10.1086/315372. [PubMed:10762573].
  21. Morrissey I, Salman H, Bakker S, Farrell D, Bebear CM, Ridgway G. Serial passage of Chlamydia spp. in sub-inhibitory fluoroquinolone concentrations. J Antimicrob Chemother. 2002;49(5):757-61. [PubMed:12003968].
  22. Binet R, Maurelli AT. Frequency of spontaneous mutations that confer antibiotic resistance in Chlamydia spp. Antimicrob Agents Chemother. 2005;49(7):2865-73. doi:10.1128/AAC.49.7.2865-2873.2005. [PubMed:15980362]. [1168699:1168699].
  23. Binet R, Maurelli AT. Frequency of development and associated physiological cost of azithromycin resistance in Chlamydia psittaci 6BC and C. trachomatis L2. Antimicrob Agents Chemother. 2007;51(12):4267-75. doi:10.1128/AAC.00962-07. [PubMed:17908942]. [2167982:2167982].
  24. Binet R, Bowlin AK, Maurelli AT, Rank RG. Impact of azithromycin resistance mutations on the virulence and fitness of Chlamydia caviae in guinea pigs. Antimicrob Agents Chemother. 2010;54(3):1094-101. doi:10.1128/AAC.01321-09. [PubMed:20065052]. [2826001:2826001].
  25. Yokoi Sh, Yasuda M, Ito S, Takahashi Y, Ishihara S, Deguchi T, et al. Uncommon occurrence of fluoroquinolone resistance-associated alterations in GyrA and ParC in clinical strains of Chlamydia trachomatis. J Infect Chemother. 2004;10(5):262-7. doi:10.1007/s10156-004-0332-4. [PubMed:16163459].

 

 

 

 


International Journal of Pharmaceutical and Phytopharmacological Research
© 2021 All rights reserved